ID: 1183781462_1183781474

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1183781462 1183781474
Species Human (GRCh38) Human (GRCh38)
Location 22:40001831-40001853 22:40001857-40001879
Sequence CCAGAAGTTAGGGAGCCCCACCC AGATTAGAGGTAGGGGAATTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!