ID: 1183784374_1183784394

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1183784374 1183784394
Species Human (GRCh38) Human (GRCh38)
Location 22:40021155-40021177 22:40021208-40021230
Sequence CCAGCGTGTGGCCCACAAGGAGC CGGAGGGGCAGGTGGGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 126} {0: 1, 1: 2, 2: 16, 3: 150, 4: 1388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!