ID: 1183787167_1183787173

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1183787167 1183787173
Species Human (GRCh38) Human (GRCh38)
Location 22:40036415-40036437 22:40036435-40036457
Sequence CCCTCATGCAGGTTCATCCTTAG TAGAGGGCTGCGGTCTTATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97} {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!