ID: 1183821066_1183821075

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1183821066 1183821075
Species Human (GRCh38) Human (GRCh38)
Location 22:40346455-40346477 22:40346480-40346502
Sequence CCGCGTGAAGGAAGTCCCGCCCC CCCGTCCTGCCCTGGCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 82} {0: 1, 1: 0, 2: 9, 3: 59, 4: 575}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!