ID: 1183823944_1183823954

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1183823944 1183823954
Species Human (GRCh38) Human (GRCh38)
Location 22:40370554-40370576 22:40370586-40370608
Sequence CCCCCAGCATGACCCGCGGCCGC GCCCCGCCACGCGTGCGCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 106} {0: 1, 1: 0, 2: 0, 3: 6, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!