ID: 1183830796_1183830810

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1183830796 1183830810
Species Human (GRCh38) Human (GRCh38)
Location 22:40417518-40417540 22:40417550-40417572
Sequence CCAGTGGCCAGGGGGCTGGGGGT CCTTGTAGGGGGCGGGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 66, 4: 559} {0: 1, 1: 1, 2: 11, 3: 73, 4: 722}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!