ID: 1183831646_1183831656

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1183831646 1183831656
Species Human (GRCh38) Human (GRCh38)
Location 22:40421243-40421265 22:40421277-40421299
Sequence CCGTACACCCCGTGAAAAGCAGA AAATGTGCCAGGAAAGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 90} {0: 1, 1: 0, 2: 4, 3: 47, 4: 542}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!