ID: 1183856031_1183856039

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1183856031 1183856039
Species Human (GRCh38) Human (GRCh38)
Location 22:40636040-40636062 22:40636070-40636092
Sequence CCAACAAGTCCAGCTGAGCCTCC GGAATCCCAAGGACTGCACTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!