ID: 1183857168_1183857170

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1183857168 1183857170
Species Human (GRCh38) Human (GRCh38)
Location 22:40642636-40642658 22:40642663-40642685
Sequence CCTACGTCTACTATTAAACTATA TTGCATGTGTATATGGAGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 21, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!