ID: 1183884053_1183884056

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1183884053 1183884056
Species Human (GRCh38) Human (GRCh38)
Location 22:40862240-40862262 22:40862266-40862288
Sequence CCAAATAGAGCTAGTCCAGAGTC CCAGACCATCCTGAATCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 56} {0: 1, 1: 0, 2: 1, 3: 30, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!