ID: 1183903293_1183903315

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1183903293 1183903315
Species Human (GRCh38) Human (GRCh38)
Location 22:41022026-41022048 22:41022065-41022087
Sequence CCCGCCCAGGGCTGGGCCGGAGG CCCGGGGGCGCGCGCCGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 75, 4: 582} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!