ID: 1183931103_1183931112

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1183931103 1183931112
Species Human (GRCh38) Human (GRCh38)
Location 22:41236723-41236745 22:41236767-41236789
Sequence CCATCTTCCCTCAGCAGAAGAGA CCAGCCAGGAAGTGCAGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 313} {0: 1, 1: 0, 2: 2, 3: 27, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!