ID: 1183932645_1183932649

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1183932645 1183932649
Species Human (GRCh38) Human (GRCh38)
Location 22:41245162-41245184 22:41245193-41245215
Sequence CCTACGTGGCCGACTGCCAATGA TGCCCTCTAAGAAACCTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28} {0: 1, 1: 0, 2: 0, 3: 12, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!