ID: 1183933902_1183933910

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1183933902 1183933910
Species Human (GRCh38) Human (GRCh38)
Location 22:41250901-41250923 22:41250947-41250969
Sequence CCATGAGAGCGCTGGGGCTGACG CCTGGGGCCCACGAGCATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 96} {0: 1, 1: 0, 2: 2, 3: 12, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!