ID: 1183956410_1183956419

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1183956410 1183956419
Species Human (GRCh38) Human (GRCh38)
Location 22:41382728-41382750 22:41382763-41382785
Sequence CCAGCTACTAGGTCCAACGGGAG GGGGCTTCTGCTGAGCGGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 1, 3: 17, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!