ID: 1183964680_1183964697

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1183964680 1183964697
Species Human (GRCh38) Human (GRCh38)
Location 22:41434624-41434646 22:41434672-41434694
Sequence CCTACTTGGGGTCCCTGGGTAGG TTTGGTGCTTTCTGGTGATTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 161} {0: 1, 1: 0, 2: 1, 3: 25, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!