ID: 1183964801_1183964808

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1183964801 1183964808
Species Human (GRCh38) Human (GRCh38)
Location 22:41435247-41435269 22:41435283-41435305
Sequence CCTTCCACAGTCTGCAAACCAGT TTTTCCTCTGGGAGTGTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 177} {0: 1, 1: 0, 2: 0, 3: 41, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!