ID: 1183985633_1183985638

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1183985633 1183985638
Species Human (GRCh38) Human (GRCh38)
Location 22:41568743-41568765 22:41568792-41568814
Sequence CCTGTCTTTGCTGTGGCTCTTCT TGCCACCTGAGAGCCCATCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!