ID: 1184001164_1184001170

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1184001164 1184001170
Species Human (GRCh38) Human (GRCh38)
Location 22:41674670-41674692 22:41674701-41674723
Sequence CCACCCTGCTTCTGTCTGCTCTG TTCCAAAAAGGGAGGATAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 105, 4: 813} {0: 1, 1: 0, 2: 5, 3: 37, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!