ID: 1184017019_1184017027

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1184017019 1184017027
Species Human (GRCh38) Human (GRCh38)
Location 22:41793976-41793998 22:41794029-41794051
Sequence CCTCCTGCTCCAGCCTTCCATTC TTCTTTTAGCAGCACTGCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 84, 4: 1127} {0: 1, 1: 0, 2: 0, 3: 15, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!