ID: 1184028702_1184028705

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1184028702 1184028705
Species Human (GRCh38) Human (GRCh38)
Location 22:41877971-41877993 22:41878012-41878034
Sequence CCTACTCTTCTCTTATGGCTGGT GAGCGTCTTTGTGAAGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 177} {0: 1, 1: 0, 2: 0, 3: 14, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!