ID: 1184043465_1184043485

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1184043465 1184043485
Species Human (GRCh38) Human (GRCh38)
Location 22:41957999-41958021 22:41958047-41958069
Sequence CCCTCCACGCTATCCCTCTGCAG AGGTGCGCTGGCAGTGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 287} {0: 1, 1: 0, 2: 9, 3: 41, 4: 414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!