ID: 1184088454_1184088467

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1184088454 1184088467
Species Human (GRCh38) Human (GRCh38)
Location 22:42279960-42279982 22:42280013-42280035
Sequence CCTCTGGGGAGCTGCTACTGGGC GGTGAGTTACTAGCAGGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 178} {0: 1, 1: 0, 2: 0, 3: 3, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!