ID: 1184100296_1184100316

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1184100296 1184100316
Species Human (GRCh38) Human (GRCh38)
Location 22:42338450-42338472 22:42338503-42338525
Sequence CCCGTCCCTCCCGGCAGCCCGGC GCTCGCTCAGGGGCTGCGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!