ID: 1184105135_1184105143 |
View in Genome Browser |
Spacer: 18 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1184105135 | 1184105143 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 22:42363017-42363039 | 22:42363058-42363080 |
| Sequence | CCTGCCTCCTGGGCCCAGGACAC | TGGTCAGTCCAGGCCTTCTGAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 2, 2: 4, 3: 76, 4: 510} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||