ID: 1184108840_1184108865

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1184108840 1184108865
Species Human (GRCh38) Human (GRCh38)
Location 22:42383704-42383726 22:42383757-42383779
Sequence CCCAGTGCTGCTTGGGGGCAGGG CCCTGGGCACATTTGGGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 355} {0: 1, 1: 0, 2: 0, 3: 14, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!