ID: 1184123869_1184123878

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1184123869 1184123878
Species Human (GRCh38) Human (GRCh38)
Location 22:42472904-42472926 22:42472926-42472948
Sequence CCAGGAACCGCCCTGGCCATGGC CTGAGAGGCAGGAGCCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 272} {0: 1, 1: 1, 2: 9, 3: 136, 4: 1113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!