ID: 1184129457_1184129462

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1184129457 1184129462
Species Human (GRCh38) Human (GRCh38)
Location 22:42509142-42509164 22:42509155-42509177
Sequence CCCAAGGAGACATGGGCGCCAGG GGGCGCCAGGAATCTCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 129} {0: 1, 1: 1, 2: 0, 3: 12, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!