ID: 1184131596_1184131599

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1184131596 1184131599
Species Human (GRCh38) Human (GRCh38)
Location 22:42519754-42519776 22:42519776-42519798
Sequence CCGCGCGGCGCACTTCCTCCTGC CGCGCCACCATCTTGCCACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 160} {0: 2, 1: 0, 2: 1, 3: 3, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!