ID: 1184140135_1184140143

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1184140135 1184140143
Species Human (GRCh38) Human (GRCh38)
Location 22:42573721-42573743 22:42573740-42573762
Sequence CCTGGGAGGCCTCCAAGTCCCTA CCTAGGGTTAGACACCTCCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 19, 4: 227} {0: 1, 1: 0, 2: 1, 3: 3, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!