ID: 1184142719_1184142728

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1184142719 1184142728
Species Human (GRCh38) Human (GRCh38)
Location 22:42587645-42587667 22:42587685-42587707
Sequence CCTCCATTATCAATGGTCAAAGC CTGGCTCCACAGATGGAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 155} {0: 1, 1: 0, 2: 1, 3: 20, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!