ID: 1184152130_1184152137

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1184152130 1184152137
Species Human (GRCh38) Human (GRCh38)
Location 22:42645416-42645438 22:42645431-42645453
Sequence CCCGCTTGTCCTCCAAGAGCACA AGAGCACAGGCCTCAGAGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 43, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!