ID: 1184181506_1184181512

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1184181506 1184181512
Species Human (GRCh38) Human (GRCh38)
Location 22:42830968-42830990 22:42831007-42831029
Sequence CCACTTTATAGTCTATTATGAAT ACAGAAGGGTCGGCCAGGTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 73, 4: 545}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!