ID: 1184199249_1184199253

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1184199249 1184199253
Species Human (GRCh38) Human (GRCh38)
Location 22:42954486-42954508 22:42954507-42954529
Sequence CCTGGGTGTAAGCGATCCTCCCA CACTTGAGCCTTCTGAAGCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 24, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!