ID: 1184205677_1184205685

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1184205677 1184205685
Species Human (GRCh38) Human (GRCh38)
Location 22:43001019-43001041 22:43001038-43001060
Sequence CCCTTGGGCCCCGTCCGACCTCA CTCAAATAAAACTTAGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!