ID: 1184219800_1184219804

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1184219800 1184219804
Species Human (GRCh38) Human (GRCh38)
Location 22:43092540-43092562 22:43092580-43092602
Sequence CCAACCAACTGTACATTTGCAAA TCAAAAAAAGAGGCCAGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 23, 4: 274} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!