ID: 1184232997_1184233009

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1184232997 1184233009
Species Human (GRCh38) Human (GRCh38)
Location 22:43168591-43168613 22:43168638-43168660
Sequence CCCTCCAGACTCTGCACCGCAGG CTTTCCCCAACCCAGATTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 151} {0: 1, 1: 0, 2: 2, 3: 25, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!