ID: 1184391683_1184391699

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1184391683 1184391699
Species Human (GRCh38) Human (GRCh38)
Location 22:44206831-44206853 22:44206884-44206906
Sequence CCACCTTTTCCAGCCCAGCTCCC GGGCCCCAGAGTCACCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 675} {0: 1, 1: 0, 2: 1, 3: 29, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!