ID: 1184391686_1184391699

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1184391686 1184391699
Species Human (GRCh38) Human (GRCh38)
Location 22:44206844-44206866 22:44206884-44206906
Sequence CCCAGCTCCCCACACCCACCTGC GGGCCCCAGAGTCACCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 92, 4: 901} {0: 1, 1: 0, 2: 1, 3: 29, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!