ID: 1184391694_1184391699

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1184391694 1184391699
Species Human (GRCh38) Human (GRCh38)
Location 22:44206859-44206881 22:44206884-44206906
Sequence CCACCTGCTTCTCACTCGGGAGG GGGCCCCAGAGTCACCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 172} {0: 1, 1: 0, 2: 1, 3: 29, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!