ID: 1184396811_1184396814

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1184396811 1184396814
Species Human (GRCh38) Human (GRCh38)
Location 22:44247124-44247146 22:44247144-44247166
Sequence CCAGGAGAGGGAGGCAAGGCCAC CACCAGTTCCTTTTTGGCAGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 36, 4: 368} {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!