ID: 1184401456_1184401472

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1184401456 1184401472
Species Human (GRCh38) Human (GRCh38)
Location 22:44276975-44276997 22:44277014-44277036
Sequence CCCCAGTTCCCCTCAGCCCCTCC CCTAAGCTGCTCTCTCTGCCGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 8, 3: 80, 4: 830} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!