ID: 1184459211_1184459222

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1184459211 1184459222
Species Human (GRCh38) Human (GRCh38)
Location 22:44627736-44627758 22:44627766-44627788
Sequence CCCCGCAGAGCCCATGCATGTGC CACCGCGGCCTGTGCTGGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 178, 4: 2889}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!