ID: 1184459333_1184459343

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1184459333 1184459343
Species Human (GRCh38) Human (GRCh38)
Location 22:44628234-44628256 22:44628285-44628307
Sequence CCCAGGGGCTGGGGCCAGGGCAG TCCCTGTCACCCACCCATCAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 18, 3: 104, 4: 887} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!