ID: 1184464951_1184464954

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1184464951 1184464954
Species Human (GRCh38) Human (GRCh38)
Location 22:44663510-44663532 22:44663527-44663549
Sequence CCTTTTCTCACTCTGACCCTCCT CCTCCTGCCCACCTCTTATAAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 39, 3: 174, 4: 901} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!