ID: 1184466202_1184466216

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1184466202 1184466216
Species Human (GRCh38) Human (GRCh38)
Location 22:44669888-44669910 22:44669934-44669956
Sequence CCCTCCGGCCTTCTGCACTCGGC AAGCTGGGGCTCTCCAAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!