ID: 1184467414_1184467422

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1184467414 1184467422
Species Human (GRCh38) Human (GRCh38)
Location 22:44677013-44677035 22:44677052-44677074
Sequence CCCTCTGCCCTTTGGCCATGTGA AAGCCATTCGGCTGCCCCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 85, 4: 511} {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!