ID: 1184505149_1184505157

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1184505149 1184505157
Species Human (GRCh38) Human (GRCh38)
Location 22:44896022-44896044 22:44896054-44896076
Sequence CCTTCCTTACCTTCCAAATGTTC CAGGCCTAGCGCTACCATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 433} {0: 1, 1: 0, 2: 0, 3: 1, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!