ID: 1184521722_1184521730

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1184521722 1184521730
Species Human (GRCh38) Human (GRCh38)
Location 22:44998527-44998549 22:44998565-44998587
Sequence CCCCTTGGTTCTCACATCCTATG ATAAGCCATCAGGCCAAGGCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!