ID: 1184533513_1184533522

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1184533513 1184533522
Species Human (GRCh38) Human (GRCh38)
Location 22:45071473-45071495 22:45071516-45071538
Sequence CCTGGAAAGGGACAGAAGAAGCG AGGGAGCAGGGGGCACCGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 38, 4: 489}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!